View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12369_low_6 (Length: 217)
Name: NF12369_low_6
Description: NF12369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12369_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 43 - 199
Target Start/End: Original strand, 29980203 - 29980359
Alignment:
| Q |
43 |
gtttgtgtttgggtttggtttgactcagtagcaacagatgaagaagaaagaaagtgagacttgggtgagtggtgtggtcttggccccgtcggcggtctgg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29980203 |
gtttgtgtttgggtttggtttgactcagtagcaacagatgaagaagaaagaaagtgagacttgggtgagtggtgtggtcttggccccgtcggcggtctgg |
29980302 |
T |
|
| Q |
143 |
tctatgccaaggctcaaggctggcaaccttccataattttctcaccaacacgtgggc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29980303 |
tctatgccaaggctcaaggctggcaaccttccataattttctcaccaacacgtgggc |
29980359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University