View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12370_high_10 (Length: 234)
Name: NF12370_high_10
Description: NF12370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12370_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 224
Target Start/End: Complemental strand, 54836810 - 54836595
Alignment:
| Q |
10 |
agtgagatgaagatgaagatagagtgaattagtatcactacttactgagatcgtttttgtgaataatgtcaaaattattttttctgaaatatttacggat |
109 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54836810 |
agtgaaatgaagatgaagaaagagtgaattagtatcactacttactgagatcgtttttgtgaataatgtcaaaattattttttctgaaatatttacggat |
54836711 |
T |
 |
| Q |
110 |
gacatctccggcggcgtcggcggctttgttagcgacgtcggagaagtgattgagttggtgaggaggcgaagatgaggaggacattgctctgattctgaat |
209 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54836710 |
gacatctccagcggcgttggcggctttgttagcgacgtcggagaagtgattgagttggtgaggaggcgaagatgaggaggacattgctctgattctgaat |
54836611 |
T |
 |
| Q |
210 |
ttgggag-tgatgatg |
224 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
54836610 |
ttgggagatgatgatg |
54836595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University