View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12371_low_1 (Length: 400)
Name: NF12371_low_1
Description: NF12371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12371_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 18 - 393
Target Start/End: Original strand, 35042375 - 35042750
Alignment:
| Q |
18 |
aacatcatgtggcactcacctgacttccatccaaaagaggagtgtcgttgacattatcagtacatctttctaacaacatgtttctgagatgggatacttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042375 |
aacatcatgtggcactcacctgacttccatccaaaagaggagtgtcgttgacattatcagtacatctttctaacaacatgtttctgagatgggatacttc |
35042474 |
T |
|
| Q |
118 |
cttcataaggtcttgggcaacctcttcggcatctagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042475 |
cttcataaggtcttgggcaacctcttcggcatctagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaa |
35042574 |
T |
|
| Q |
218 |
catgtgcaaagccctctgcatcctcttgggttttttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctgtgactttcattttgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35042575 |
catgtgcaaagccctctgcatcctcttgggttttttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctctgactttcattttgg |
35042674 |
T |
|
| Q |
318 |
acaagctccgacaacatccaggtgtttcaggtgatttctctccgttggacaaggcaggtgaacctacttcttctct |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042675 |
acaagctccgacaacatccaggtgtttcaggtgatttctctccgttggacaaggcaggtgaacctacttcttctct |
35042750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University