View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12371_low_3 (Length: 354)
Name: NF12371_low_3
Description: NF12371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12371_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 53032208 - 53032010
Alignment:
| Q |
22 |
ttatgtatgtagtagtaatgaagtgatgtgaaaagggaataatgaggaaaagaaagcggaacaaggaagcaaagagtcagcaatcactttgaaatcccaa |
121 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53032208 |
ttatgtatgtagtagt---gaagtgatgtgaaaagggaataatgaagaaaagaaagcagaacaaggaagcaaagagtcagcaatcactttgaaatcccaa |
53032112 |
T |
 |
| Q |
122 |
tatccaaaagtgaataacaatttgtgtcattgcttatccctctttatagtatctctagttttgctttctactatttctaaatttaatttaataatgagag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53032111 |
tatccaaaagtgaataacaatttgtgtcattgcttatccctctttatagtatctctagttttactttctactatttctaaatttaatttaataatgagag |
53032012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 290 - 338
Target Start/End: Complemental strand, 53031941 - 53031893
Alignment:
| Q |
290 |
gtataatatatgtccatatcttttcttctcttctctcgtctcatctcat |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53031941 |
gtataatatatgtccatatcttttcttctcttctctcgtctcatctcat |
53031893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University