View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12375_high_1_N (Length: 433)
Name: NF12375_high_1_N
Description: NF12375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12375_high_1_N |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 53 - 422
Target Start/End: Complemental strand, 4573876 - 4573516
Alignment:
| Q |
53 |
ctctcacactatcacgtgttttccaagccactaatcccaaacaaaagatatcaacccttagagaatacctttttctaacgatcactttatttggtttcat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
4573876 |
ctctcacactatcacgtgttttccaagccactaatcccacacaaaagacatcaacccttagagaatatctttt-ctaacgatcactttatttggtttcat |
4573778 |
T |
|
| Q |
153 |
taaattagccatagagaacaagttttgaccttttacacactctaaaagctgaaaattcggatcccaagattatcctctgcacccagtgtagctccacata |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4573777 |
taaattagccatagagaacaagttttgaccttttacacactctaaaagctgaaaattcggatcccaggattatcctctgcacccagtgtagctccacata |
4573678 |
T |
|
| Q |
253 |
aatctatgcgtttcacgcagcttgctcatgtgtctagcgcagctggtagaaacaga---tcttgaaacatcaacacagccgcacctagcgcagcagtccc |
349 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4573677 |
aatctatgcgtttcacgcagcttgctcgtgtgtctagcgcagcttgtagaaacagatcttcttgaaacatcaacacagccgcacctagcgcagcagtccc |
4573578 |
T |
|
| Q |
350 |
tacgcctagagcatgggacaaaacgccgtcatatttctccgactttcaacatatgatttcaagacacatctca |
422 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4573577 |
tac-----------gggacaaaacgccgtcatatttctccgacattcaacatatgatttcaagacacatctca |
4573516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University