View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12376_high_4 (Length: 273)

Name: NF12376_high_4
Description: NF12376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12376_high_4
NF12376_high_4
[»] chr6 (2 HSPs)
chr6 (16-80)||(9577314-9577378)
chr6 (198-254)||(9577149-9577205)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 9577378 - 9577314
Alignment:
16 atgaacataagaaggggttagaaatttaaaaccttaatataactaaacgtttgaacataacataa 80  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9577378 atgaacataagaaggggttagaaatttaaaaccttaatataactaaacgtttgaacataacataa 9577314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 198 - 254
Target Start/End: Complemental strand, 9577205 - 9577149
Alignment:
198 gacaactagaagtaaaattaaagaataaaatggatagaagaaattgaagttgttcca 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9577205 gacaactagaagtaaaattaaagaataaaatggatagaagaaattgaagttgttcca 9577149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University