View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12376_low_5 (Length: 215)
Name: NF12376_low_5
Description: NF12376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12376_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 108 - 198
Target Start/End: Complemental strand, 45375095 - 45375005
Alignment:
| Q |
108 |
tgatggcagaataattgaaagagggaccttgcaatgtattaatttcggttggtgtgcatgccgctgggtccttcttgcagtggttccagtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45375095 |
tgatggcagaataattgaaagagggaccttgcaatgtattaatttcggttggtgtgcatgccgctgggtccttcttgcagtggatccagtg |
45375005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 108 - 198
Target Start/End: Complemental strand, 45390253 - 45390163
Alignment:
| Q |
108 |
tgatggcagaataattgaaagagggaccttgcaatgtattaatttcggttggtgtgcatgccgctgggtccttcttgcagtggttccagtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45390253 |
tgatggcagaataattgaaagagggaccttgcaatgtattaatttcggttggtgtgcatgccgctgggtccttcttgcaatggttccagtg |
45390163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 45375202 - 45375155
Alignment:
| Q |
1 |
agtaaactacttaattctttgacaaaagatactaacatgcttattaac |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45375202 |
agtaaactacttaattctttgacaaaagatactaacatgcttattaac |
45375155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 45390359 - 45390312
Alignment:
| Q |
1 |
agtaaactacttaattctttgacaaaagatactaacatgcttattaac |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45390359 |
agtaaactacttaattctttgacaaaagatactaacatgcttattaac |
45390312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 108 - 167
Target Start/End: Complemental strand, 39017922 - 39017863
Alignment:
| Q |
108 |
tgatggcagaataattgaaagagggaccttgcaatgtattaatttcggttggtgtgcatg |
167 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39017922 |
tgatggctgaacaattgaaagagggaccttgcaatgtattaatttcggctggtgtgcatg |
39017863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 39018035 - 39017999
Alignment:
| Q |
1 |
agtaaactacttaattctttgacaaaagatactaaca |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39018035 |
agtaaactacttaattctttgacaaaagatactaaca |
39017999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University