View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12377_high_3 (Length: 367)
Name: NF12377_high_3
Description: NF12377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12377_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 78 - 361
Target Start/End: Original strand, 41705459 - 41705742
Alignment:
| Q |
78 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705459 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
41705558 |
T |
|
| Q |
178 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705559 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
41705658 |
T |
|
| Q |
278 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcatctcact |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41705659 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcatttcact |
41705742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 100 - 180
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
100 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
180 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University