View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12377_high_6 (Length: 333)
Name: NF12377_high_6
Description: NF12377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12377_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 27 - 222
Target Start/End: Original strand, 11625971 - 11626165
Alignment:
| Q |
27 |
caataaacacagcgaattgatactcgcagtacatgtttagtatcacagtggattcgttgcagtctatgattttgacaaagtcaccgtgatatcaaacatg |
126 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
11625971 |
caataaacacagcgaattgatactcacggtacatgtttagtatcacagtggattcgttgccgtctatgattt-gacaaagccaccgtgatatcaaacatg |
11626069 |
T |
|
| Q |
127 |
cacgatacagaaaacaaaaatgtccccttaatcatataaaaatcttaagtatccataattgcgccagatagcatactttaatttatcaaaaaagtt |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
11626070 |
cacgatacagaaaacaaaaatgtctccttaatcatataaaaatcttaagtatccataattgcgcgagataacatactttaatttatcaaaaaagtt |
11626165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 286 - 333
Target Start/End: Original strand, 11626229 - 11626276
Alignment:
| Q |
286 |
catccatagccgccgcgggcgaaacattttcctcaccagcaatcataa |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11626229 |
catccatagccgccgcgggcgaaacattttcctcaccatcaatcataa |
11626276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University