View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12377_high_9 (Length: 310)
Name: NF12377_high_9
Description: NF12377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12377_high_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 310
Target Start/End: Complemental strand, 28639236 - 28638941
Alignment:
| Q |
17 |
ctgatatggacaaaattaactgacgttgtggtcgctgannnnnnnataaggcactcataactttattgacaattttcagattatgtcacactgactcact |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28639236 |
ctgatatggacaaaataaactgacgttgtggtcgcggatttttttataaggcactcataactttattgacaattttcagattatgtcacactgactcact |
28639137 |
T |
 |
| Q |
117 |
tatagttccttgtgctactgattttgcttttactgtaatnnnnnnnntaaaataa--ttatgcttgctgcaaaatagagtttggcagtgataccaaaacc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28639136 |
tatagttccttgtgctactgattttgcttttactgtaataaaaaaaaaaaaaaaaaattatgcttgctgcaaaatagagtttggcagtgataccaaaacc |
28639037 |
T |
 |
| Q |
215 |
acctagatgtatttctttgtcagttgttttattcaccttttcaaaagtagagattctttttggaccattccaaaaaataataatttatttgtttgc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28639036 |
acctagatgtatttctttgtcagttgttttattcaccttttcaaaagtagagattctttttggaccattccaaaaaataataatttatttgtttgc |
28638941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University