View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12380_low_6 (Length: 362)
Name: NF12380_low_6
Description: NF12380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12380_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 31 - 354
Target Start/End: Original strand, 28896778 - 28897101
Alignment:
| Q |
31 |
taatattaatgaagagtaatacctcagaatagatgtgatcagaatcaggattagtgcctttagcaggtaaaccaagagcagcaccaatatcagaaacagc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28896778 |
taatattaatgaagagtaatacctcagaatagatgtgatcagaatcaggattagtgcctttagcaggtaaaccaagagcagaaccaatatcagaaacagc |
28896877 |
T |
 |
| Q |
131 |
aggttgaagttcagtcagagagagtttaccatctttatctctatccaactcttgaaacttatggttcacaaagttactaaaaacatctttgtttccaact |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896878 |
aggttgaagttcagtcagagagagtttaccatctttatctctatccaactcttgaaacttatggttcacaaagttactaaaaacatctttgtttccaact |
28896977 |
T |
 |
| Q |
231 |
aactccataatattagaaccatctagaacctctactgcgtttccaccaccaccaccactttttctcttaactgaaccactctccattgtgaatcctgtga |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28896978 |
aactccataatattagaaccatctagaacctctactgcgtttccaccaccaccaccactttttctcttaactgaaccactctccattgtgaatcctgtga |
28897077 |
T |
 |
| Q |
331 |
ctcacctttctctttttctctgct |
354 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
28897078 |
ctcacctttctctttttctttgct |
28897101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 60 - 130
Target Start/End: Complemental strand, 55095247 - 55095177
Alignment:
| Q |
60 |
tagatgtgatcagaatcaggattagtgcctttagcaggtaaaccaagagcagcaccaatatcagaaacagc |
130 |
Q |
| |
|
|||||||||||||| |||||| ||||||| | |||||| ||||||||||||||||| || |||| |||||| |
|
|
| T |
55095247 |
tagatgtgatcagagtcaggagtagtgccctgagcaggcaaaccaagagcagcaccgatgtcagcaacagc |
55095177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University