View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12382_low_10 (Length: 280)
Name: NF12382_low_10
Description: NF12382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12382_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 3189507 - 3189338
Alignment:
| Q |
19 |
agaataagcagttccaagtccctccacacgttagccattgccttatctttgtttccctccaaacaatattcaccttcaatgaattccccaaatgcacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3189507 |
agaataagcagttccaagtccctccacacgttagccattgccttatctttgtttccctccaaacaatattcaccttcaatgaattccccaaatgcacaaa |
3189408 |
T |
 |
| Q |
119 |
ataataatgttactaccctcataactagaactagctccatcatcaccaatacaatattctttattaatta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3189407 |
ataataatgttactaccctcataactagaactagctccatcaccaccaatacaatattctttattaatta |
3189338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 215 - 275
Target Start/End: Complemental strand, 3189320 - 3189260
Alignment:
| Q |
215 |
ggctagtaaattattagcattcacattgacatgcccttcaagtccatcattctctgcttct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3189320 |
ggctagtaaattattagcattcacattgacatgcccttcaagtccatcattctctacttct |
3189260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University