View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12382_low_12 (Length: 247)
Name: NF12382_low_12
Description: NF12382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12382_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 22 - 232
Target Start/End: Original strand, 31572201 - 31572418
Alignment:
| Q |
22 |
gagcatgggcaattcgtaacacaaagaaagaacaagagatttcggggagcacagatgcatacagaacacacaacttcatgcattccaattattgaaaata |
121 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31572201 |
gagcatgggcaatttgtaacagaaagaaagaacaagagatttcggggagcacagatgcatactgaacacacaacttcatgcattccaattattgaaaata |
31572300 |
T |
|
| Q |
122 |
aagaattcatgg-------ttacaatacataagaaactacacaatatgaagaatcatcgcacacaagcttattcttgttcggaaatgcactccacccagt |
214 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
31572301 |
aataattcatggttacaacttacaatacataagaaactacacaatatgaagcatcatcgcacacaagcttattcttgttcagaaatttactccacccagt |
31572400 |
T |
|
| Q |
215 |
tatgagcaaatgtctctg |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31572401 |
tatgagcaaatgtctctg |
31572418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 123 - 232
Target Start/End: Original strand, 11492547 - 11492655
Alignment:
| Q |
123 |
agaattcatggttacaatacataagaaactacacaatatgaagaatcatcgcacacaagcttattcttgttcggaaatgcactccacccagttatgagca |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
11492547 |
agaattca-ggttacaatacataagaaactacacaatatgaagcatcactgcacacaagctttttcttgtttgaaaatgcactccacccagttatgagca |
11492645 |
T |
|
| Q |
223 |
aatgtctctg |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
11492646 |
aatgtctctg |
11492655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 145 - 231
Target Start/End: Complemental strand, 24730374 - 24730288
Alignment:
| Q |
145 |
aagaaactacacaatatgaagaatcatcgcacacaagcttattcttgttcggaaatgcactccacccagttatgagcaaatgtctct |
231 |
Q |
| |
|
||||||||||||||||| ||| |||| || ||||||| | |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24730374 |
aagaaactacacaatattaagcatcactgctcacaagcattttcttgttcgcaaatgcactccacccagttatgagcaaatgtctct |
24730288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 22 - 119
Target Start/End: Complemental strand, 24730034 - 24729939
Alignment:
| Q |
22 |
gagcatgggcaattcgtaacacaaagaaagaacaagagatttcggggagcacagatgcatacagaacacacaacttcatgcattccaattattgaaaa |
119 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||| | |||||| || ||||||||||||||||||||||||| |||||||||||| ||||| |||||| |
|
|
| T |
24730034 |
gagcatgggcaattggtaacacagaga--gaacaggggatttcaggtagcacagatgcatacagaacacacagcttcatgcattcaaattactgaaaa |
24729939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 27057828 - 27057880
Alignment:
| Q |
180 |
agcttattcttgttcggaaatgcactccacccagttatgagcaaatgtctctg |
232 |
Q |
| |
|
||||| || ||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27057828 |
agcttttttttgttcgcaaatgcactccacccaattatgagcaaatgtctctg |
27057880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 39833646 - 39833594
Alignment:
| Q |
180 |
agcttattcttgttcggaaatgcactccacccagttatgagcaaatgtctctg |
232 |
Q |
| |
|
||||| || ||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39833646 |
agctttttattgttcgcaaatgcactccacccaattatgagcaaatgtctctg |
39833594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University