View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12382_low_9 (Length: 301)
Name: NF12382_low_9
Description: NF12382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12382_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 191 - 291
Target Start/End: Complemental strand, 15943897 - 15943797
Alignment:
| Q |
191 |
taggaggttgtgttattgtggcttgttctggaatttcaataggatacaaagtttcaatgttttgaggtgaatttgtttggcaatagaaagttggtattag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15943897 |
taggaggttgtgttattgtggcttgttctggaatttcaataggatacaaagtttcaatgttttgaggtgaatttgtttggcaatagaaagttggtattag |
15943798 |
T |
 |
| Q |
291 |
a |
291 |
Q |
| |
|
| |
|
|
| T |
15943797 |
a |
15943797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 19 - 121
Target Start/End: Complemental strand, 15944069 - 15943967
Alignment:
| Q |
19 |
ctacaacacttaataacaaagaagaaaattagagcagaaagaactaatgttcctgctgcagttgcagctacagcagttactatcttactatttgttgaag |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15944069 |
ctacaacacttattaacaaagaagaaaattagagcagaaagaactaatgttcctgctgcagttgcagctacagcagttactatcttactatttgttgaag |
15943970 |
T |
 |
| Q |
119 |
aat |
121 |
Q |
| |
|
||| |
|
|
| T |
15943969 |
aat |
15943967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University