View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12385_high_12 (Length: 241)
Name: NF12385_high_12
Description: NF12385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12385_high_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 9 - 241
Target Start/End: Original strand, 16487766 - 16487998
Alignment:
| Q |
9 |
ggtcgagtgagatgaatggggcaatacaccaattcacccaatttcattttcaaccacaagtgaaacagcgttcatttccgtattcagagaaacagcgttc |
108 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16487766 |
ggtcgggtgacatgaatggggcaatacaccaattcacccaatttcattttcaaccacaagtgaaacagcgttcatttccgtattcagagaaacagcgttc |
16487865 |
T |
|
| Q |
109 |
tgaatctaaatttctagggtttgcggaatcaatcgagcaattcagcaatggcgatgaggagattctacagcgagatcaaggggaagaaagttaccgaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16487866 |
tgaatctaaatttctagggtttgcggaatcaatcgagcaattcagcaatggcgatgaggagattctacagcgagatcaaggggaagaaagttaccgaact |
16487965 |
T |
|
| Q |
209 |
ccccgaacacgtgaaaccgatgctttcattcaa |
241 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
16487966 |
ccccgaacacgtgaaaccaatgctttcattcaa |
16487998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University