View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12385_high_7 (Length: 322)
Name: NF12385_high_7
Description: NF12385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12385_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 14 - 307
Target Start/End: Complemental strand, 33554488 - 33554195
Alignment:
| Q |
14 |
ggagcacagaatcttgtggtgccaattttgcaaacaaaaagaggtggaatttcaaggagaaaacagcaacaaaagtcatcaacaatcaacaaccacaacg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554488 |
ggagcacagaatcttgtggtgccaattttgcaaacaaaaagaggtggaatttcaaggagaaaacagcaacaaaagtcatcaacaatcaacaaccacaacg |
33554389 |
T |
 |
| Q |
114 |
gtgttgaattctgttggttaacacaagaggatgtgatcaggttcttgcttggttccattggcctcttcactccactccctgcatactccattgattctct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554388 |
gtgttgaattctgttggttaacacaagaggatgtgatcaggttcttgcttggttccattggcctcttcactccactccctgcatactccattgattctct |
33554289 |
T |
 |
| Q |
214 |
cgatatcatcagccccgatgtgctcgcaatcgattactattcccctgcgtcttccgctgttgaagccatctcaaagtcgcttgcacaacaaact |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554288 |
cgatatcatcagccccgatgtgctcgcaatcgattactattcccctgcgtcttccgctgttgaagccatctcaaagtcgcttgcacaacaaact |
33554195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 17 - 307
Target Start/End: Complemental strand, 33541264 - 33540974
Alignment:
| Q |
17 |
gcacagaatcttgtggtgccaattttgcaaacaaaaagaggtggaatttcaaggagaaaacagcaacaaaagtcatcaacaatcaacaaccacaacggtg |
116 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||||||| |||||| ||||||||||||||| ||| || ||||||| ||||||||||| |||||| |||| |
|
|
| T |
33541264 |
gcacaaaatcttgtggtgccaatttcgcagacaaaaaaaggtggcctttcaaggagaaaactgcagcagaagtcattaacaatcaacagccacaatggtg |
33541165 |
T |
 |
| Q |
117 |
ttgaattctgttggttaacacaagaggatgtgatcaggttcttgcttggttccattggcctcttcactccactccctgcatactccattgattctctcga |
216 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||| | ||||| ||| |||| | |
|
|
| T |
33541164 |
ttgagttctgctggttaacacaagaggatgtgatcaggttcttgcttggttccattggccgcttcagtgcactccctgcacaatccatcgatcgtctcaa |
33541065 |
T |
 |
| Q |
217 |
tatcatcagccccgatgtgctcgcaatcgattactattcccctgcgtcttccgctgttgaagccatctcaaagtcgcttgcacaacaaact |
307 |
Q |
| |
|
||| |||||| | ||||||||| | || ||||||| |||||| || ||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
33541064 |
tattatcagctcggatgtgctctccattgattactcttccccggcatcttctgctgttgaagccatctcaaagtccctcacacaacaaact |
33540974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University