View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12385_low_13 (Length: 238)
Name: NF12385_low_13
Description: NF12385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12385_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 39396324 - 39396546
Alignment:
| Q |
1 |
ttatcattatgcatgattgacttgatatttggtttgattgccatgtacaaatatttacaggttgatgaactaccatttggagaccacgaccttcaaatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396324 |
ttatcattatgcatgattgacttgatgtttggtttgattgccatgtacaaatatttacaggttgatgaactaccatttggagaccacgaccttcaaatcc |
39396423 |
T |
|
| Q |
101 |
tatatgtcgagtatataaaattgcgtttggctaacaagatatgtcctagttattttgttcaaagtaaatttttcaaggatcacatgacaatattgtccgc |
200 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396424 |
tatatgtcgagtatatacaattgtgtttggctaacaagatatgtcctagttattttgttcaaagtaaatttttcaaggatcacatgacaatattgtccgc |
39396523 |
T |
|
| Q |
201 |
tgaaactagtccactgagatata |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39396524 |
tgaaactagtccactgagatata |
39396546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 30436808 - 30436858
Alignment:
| Q |
1 |
ttatcattatgcatgattgacttgatatttggtttgattgccatgtacaaa |
51 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
30436808 |
ttatcattatgcataattgacttgatgtttggtttgcttgccctgtacaaa |
30436858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University