View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12385_low_6 (Length: 329)
Name: NF12385_low_6
Description: NF12385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12385_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 83 - 301
Target Start/End: Complemental strand, 38509852 - 38509632
Alignment:
| Q |
83 |
agaaccataagttgtatacatttgaaatagttgtannnnnnnncagctgtttggatgcagtatata--cttaatgtttctttttacctttctatcctcgt |
180 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38509852 |
agaaccataagttctatacatttgaaatagttgtattttttttcagctgttcggatgcagtatatatacttaatgtttctttttacctttctatcctcgt |
38509753 |
T |
 |
| Q |
181 |
tgtaaaaatagtctaacatttcatctaacagatgctttcagtgcttcttgccacagttggagcagctatgtcattgataaaatttgagaattcatttgac |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38509752 |
tgtaaaaatagtctaacatttcatctaacagatgctttcagtgcttcttgccacagttggagcagctatgtcattgataaaatttgagaattcatttgac |
38509653 |
T |
 |
| Q |
281 |
aataaccatcaaagattaggt |
301 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38509652 |
aataaccatcaaagattaggt |
38509632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University