View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12385_low_8 (Length: 301)
Name: NF12385_low_8
Description: NF12385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12385_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 20 - 289
Target Start/End: Complemental strand, 45625967 - 45625698
Alignment:
| Q |
20 |
cttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccgggaacaccgccttgcgtttcttttg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45625967 |
cttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccgggaacatcgccttgcgtttcttttg |
45625868 |
T |
|
| Q |
120 |
caaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatccctcacgttcaatgttgagtgcttcctggggttcattc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45625867 |
caaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatccctcacgttcaatgttgattgcttcctggggttcattc |
45625768 |
T |
|
| Q |
220 |
ttctcatcttcacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactctctgctt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625767 |
ttctcatcttcacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactctctgctt |
45625698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University