View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12387_high_2 (Length: 363)
Name: NF12387_high_2
Description: NF12387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12387_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 25 - 254
Target Start/End: Complemental strand, 41434813 - 41434583
Alignment:
| Q |
25 |
taattgtatctcgttcaaaagaccatccaaacatacactacctaacgtttttatacatttcgatttttcttaacttttggcacaaatcctacatgaaagg |
124 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41434813 |
taattgtatctcgttcaaaagaacatccaaacataccctacctaacgtttttatacatttcgatttttcttaacttttggcacaaatcctacatgaaagg |
41434714 |
T |
|
| Q |
125 |
aaattaactgcgtatgcatggatttgtatttttaaattctatcgacccctgcatggttattgaaagtggtttctaattagtc-gataactaaactttcgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41434713 |
aaattaactgcgtatgcatggatttgtatttttaaattctatcgacccctacatggttattgaaagtggtttctaattagtcagataactaaactttcgt |
41434614 |
T |
|
| Q |
224 |
taaaattttgtgagcagctttcaacttgcaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41434613 |
taaaattttgtgagcagctttcaacttgcaa |
41434583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 319 - 356
Target Start/End: Complemental strand, 41434518 - 41434481
Alignment:
| Q |
319 |
tatattggactattaaattcgataggtgatctctgctt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41434518 |
tatattggactattaaattcgataggtgatctgtgctt |
41434481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University