View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12387_high_5 (Length: 254)
Name: NF12387_high_5
Description: NF12387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12387_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 50 - 237
Target Start/End: Original strand, 12487785 - 12487972
Alignment:
| Q |
50 |
aagtaacaaattttccccaccttgcaaactgtgctgaatttacacatgacatgagggaagggaccaattcaatcatgtctattatagtactcgatccctt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12487785 |
aagtaacaaattttccccaccttgcaaactgtactgaattcacacatgacatgagggaagggaccaattcaatcatgtctattatagtactcgatccctt |
12487884 |
T |
 |
| Q |
150 |
tatctcaaaactataaacttttagataaaagttattaattattatgataaagaaaattagacgaattaaacgagttttgttacatatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
12487885 |
tatctcaaaactataaacttttagataaaagttattaattaatatgataaagaaaattagacgaattaaacgagctttgttaaatatt |
12487972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University