View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12387_low_4 (Length: 258)
Name: NF12387_low_4
Description: NF12387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12387_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 244
Target Start/End: Complemental strand, 40411730 - 40411506
Alignment:
| Q |
20 |
acgtgttcttgctgtttgttcagaaacgatgttagcttcgtttcaaagaccaacagatgattttgctcctgctaccgatgttcttataggacatgctctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40411730 |
acgtgttcttgctgtttgttcagaaaccatgttagcttcgtttcaaagaccaaccgatgattttgctcctgctaccgatgttcttataggacatgctctt |
40411631 |
T |
 |
| Q |
120 |
ttcgcagatggtgctgccgctatgatcattgctgctgatcctaatccttctattgaacatccactctttgaaattgtttcagcttcacaaacaactgttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40411630 |
ttcgcagatggtgctgccgctatgatcattgctgctgatcctaatccttctattgaacatccactatttgaaattgtttcagcttcacaaacaactgttc |
40411531 |
T |
 |
| Q |
220 |
ctgatacccaaaactcaatcagagc |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40411530 |
ctgatacccaaaactcaatcagagc |
40411506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University