View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12388_high_3 (Length: 209)
Name: NF12388_high_3
Description: NF12388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12388_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 2943841 - 2943666
Alignment:
| Q |
15 |
aacctgtgttccattgtcaagaacagttccagtggtagtaaattgacactcagctctatcaacttcaccataatcagaatccttcaatatggcttcatta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943841 |
aacctgtgttccattgtcaagaacagttccagtggtagtaaactgacactcagctctatcaacttcaccataatcagaatccttcaatatggcttcatta |
2943742 |
T |
 |
| Q |
115 |
acaacaccnnnnnnnntactcataatataaacatcaacattttctgtatacacgtcagaaataagaatatattaag |
190 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
2943741 |
acaacaccaaaaaaaatactcataatataaacatcaacattttctgtatacatgtcagaaataacaatatattaag |
2943666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University