View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12388_low_2 (Length: 305)
Name: NF12388_low_2
Description: NF12388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12388_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 6 - 264
Target Start/End: Complemental strand, 2948298 - 2948042
Alignment:
| Q |
6 |
agctatgtacaagaaattaatgagatgggcagagaagaatttgtcagcggcataaaagggataagaaattaaattgatactcatcaatataaattcatta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2948298 |
agctatgtacaagaaattaatgagatgggcagagaagaatttgtcagcggcataaaagggataagaaattaaattgatactcatcaatataaat-catta |
2948200 |
T |
|
| Q |
106 |
tacgaggagaatagtaaaactttaatttaactgcagtatagtacagcacattcactaaactttgcgcattttttgctgcatcatttatttgcagtacatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2948199 |
tacgaggagaatagtaaaactttaatttaactgcagtatagtacagcacattcactacactttgcgcattttttgctgcatcatttatttgcagtacatt |
2948100 |
T |
|
| Q |
206 |
ctacatttatatgcatataaattgggtggttttttatgatagacaaacttacataaaca |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2948099 |
ctacatttatatgcatataaattgggtggt-ttttatgatagacaaacttacataaaca |
2948042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University