View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12390_low_10 (Length: 230)
Name: NF12390_low_10
Description: NF12390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12390_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 71 - 219
Target Start/End: Original strand, 2596656 - 2596804
Alignment:
| Q |
71 |
tgtacatattctctaacatcaaccaggtacatattcactaacgcaataaaaataaaatttgagcataattaaaccatcctaaaaaggctcttaaactaga |
170 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2596656 |
tgtaaatattctctaacatcaaccaggtacatattcactaactcaataaaaataaaaattgagcataattaaaccatcctaaaaaggctcttaaactaga |
2596755 |
T |
|
| Q |
171 |
tgaattaaagagattgcaaaataaaataatccaatatcaaaagcacagg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2596756 |
tgaattaaagagattgcaaaataaaataatccaatatcaaaagcacagg |
2596804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 2596620 - 2596661
Alignment:
| Q |
15 |
atcaaagaaagcaattgcctagaatagtgtctagcttgtaaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2596620 |
atcaaagaaagcaattgcctagaatagtgtctagcttgtaaa |
2596661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University