View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12391_low_6 (Length: 211)
Name: NF12391_low_6
Description: NF12391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12391_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 28681379 - 28681270
Alignment:
| Q |
18 |
agaagaattgtcctcgtgctcgtgcccaaagagatgtaaactttcatttggacataagcattgttactagaattatcagtgttgttctaacatgaaacc- |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28681379 |
agaagaattgtcctcgtgctcgtgcccaaagagatgtaaactttcatttgaacataagtattgttactagaattatcagtgttgttctaacatgaaacca |
28681280 |
T |
|
| Q |
117 |
atttagtttg |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
28681279 |
atttagtttg |
28681270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 7818043 - 7818002
Alignment:
| Q |
113 |
aaccatttagtttgatactttggacaatatatacatgcttgg |
154 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
7818043 |
aaccatttagtttgatagtttggacaaaatatatatgcttgg |
7818002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University