View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12393_low_5 (Length: 246)
Name: NF12393_low_5
Description: NF12393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12393_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 14924719 - 14924933
Alignment:
| Q |
16 |
gtgatttgaagcagctcggtgagtgaacaattaatacttgttgaatagtaataaaatctaataggggaatatatgattggaaaaataactggatatgttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14924719 |
gtgatttgaagcagctcggtgagtgaacaattaatacttgttgaatagtaataaaatctaataggggaatataggattggaaaaataactggatatgttg |
14924818 |
T |
|
| Q |
116 |
ttgttgcatgtttattggaatgattttatcatgaaaaattgcagtaagcctatcttgcatgcaatcaaaagttcacggtttcgagttgtcttcactcttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14924819 |
ttgttgcatgtttattggaatgattttatcatgaaaaattgcagtaagcctatcttgcatgcaatcaaaagttcacggtttcgagttgtcttcactcttg |
14924918 |
T |
|
| Q |
216 |
tagataggaggtcac |
230 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
14924919 |
tagataggagatcac |
14924933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University