View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12393_low_6 (Length: 202)
Name: NF12393_low_6
Description: NF12393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12393_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 7697946 - 7698115
Alignment:
| Q |
17 |
aaaatgtgtttcttgatttcttgatgaacatacaacttgcatttattacctacagctggcagatattggattgtgtgcatatagctttttacgatgaaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
7697946 |
aaaatgtgtttcttgatttcttgatgaacatacaacttgaatttattacctacagctggcagatattggagagggtgcatatagctttttacgatgaaag |
7698045 |
T |
|
| Q |
117 |
ttggcagaatagggaagcgtataattatgatgcagaggtgcagtagacaatatgtgtgtgcacagtgcac |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7698046 |
ttggcagaatagggaagcgtataattatgatgcagaggtgcagtagacaatgtgtgtgtgcacagtgcac |
7698115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University