View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12394_high_5 (Length: 260)
Name: NF12394_high_5
Description: NF12394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12394_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 43011154 - 43011042
Alignment:
| Q |
8 |
aaaaaacaaattaaagggagcagaaaagaa-cggttgcataaaatgacaattgagagaataaaacagtgcaagaaaaatacacactatggtattataaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43011154 |
aaaaaacaaattaaagggagcagaaaagaaacggttgcataaaatgacaagttagagaataaaacagtgcaagaaaaatacacactatggtattataaaa |
43011055 |
T |
 |
| Q |
107 |
agggagcactctc |
119 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43011054 |
agggagcactctc |
43011042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University