View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12394_high_5 (Length: 260)

Name: NF12394_high_5
Description: NF12394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12394_high_5
NF12394_high_5
[»] chr5 (1 HSPs)
chr5 (8-119)||(43011042-43011154)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 43011154 - 43011042
Alignment:
8 aaaaaacaaattaaagggagcagaaaagaa-cggttgcataaaatgacaattgagagaataaaacagtgcaagaaaaatacacactatggtattataaaa 106  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||    
43011154 aaaaaacaaattaaagggagcagaaaagaaacggttgcataaaatgacaagttagagaataaaacagtgcaagaaaaatacacactatggtattataaaa 43011055  T
107 agggagcactctc 119  Q
    |||||||||||||    
43011054 agggagcactctc 43011042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University