View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12394_high_7 (Length: 233)
Name: NF12394_high_7
Description: NF12394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12394_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 52289060 - 52288944
Alignment:
| Q |
1 |
gggaagagactttaggggttcaattcctttaacatgggaaacttaaaaaatatattagaagaatattttagagggtttagataaattctctaaactcgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52289060 |
gggaagagactttaggggttcaattcctttaacatgaggaacttaaaaaatatattagaagaatattttagagggtttagataaattctctaaacttgag |
52288961 |
T |
|
| Q |
101 |
aaatattacggtattat |
117 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52288960 |
gtatattacggtattat |
52288944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 144 - 201
Target Start/End: Complemental strand, 52288917 - 52288858
Alignment:
| Q |
144 |
ccttcaattaccattatctacaaaccttc--tctcaaaaaagatagaagatctctctccc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52288917 |
ccttcaattaccattatctacaaaccttctctctcaaaaaagatagaagatctctctccc |
52288858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University