View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12395_high_5 (Length: 375)
Name: NF12395_high_5
Description: NF12395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12395_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 109 - 367
Target Start/End: Complemental strand, 34933098 - 34932840
Alignment:
| Q |
109 |
gggggttagggtttaaaccttatgaattcgggattttctcttctttgatggaatgattatattagttttgatagagtgtgtttaattaattagtacatat |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933098 |
gggggttagggtttaaaccttgtgaattcgggattttctcttctttgatggaatgattatattagttttgatagagtgtgtttaattaattagtacatat |
34932999 |
T |
 |
| Q |
209 |
catcatcatcatctaattaccatctaacaattctgttctttcatattatctgcgaagccgactctctcccaaatcttcaacatctatagcgcaaagatga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34932998 |
catcatcatcatctaattaccatctaacaattttgttctttcatattatctgcgaagccgactctctcccaaatcttcaacatctatagtgcaaagatga |
34932899 |
T |
 |
| Q |
309 |
gatactcagcgggatgcccatcgagatacgcacacggaataactcctgcgcacaggttc |
367 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
34932898 |
gatactcagcgggatgcccatcgagatacacacacggaataactcctgcgcacatgttc |
34932840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University