View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12395_high_6 (Length: 232)
Name: NF12395_high_6
Description: NF12395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12395_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 985343 - 985534
Alignment:
| Q |
19 |
gtgagtgcaaccataatttcaaaatctagtgtataatataaaatgaaagggtgatgatgtgagacaatagagaaattctaagacataccttggcaaagga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
985343 |
gtgagtgcaaccataatttcaaaatctagtgtataatataaaatgaaagggtgatgatgtgagacaatagagaaattctaagacataccttggcaaagga |
985442 |
T |
 |
| Q |
119 |
gattgggaatcattgttgtgagcactaaagcaaacaagttttgaggaaatgggaggtgataagaggggaagatgaaggagtgaacttggtag |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
985443 |
gattgggaatcatggttgtgagcactaaagcatacaagttttgaggaaatgggaggtgataagagggtaagatgaaggagtgaacttggtag |
985534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University