View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12395_low_6 (Length: 298)
Name: NF12395_low_6
Description: NF12395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12395_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 11 - 282
Target Start/End: Original strand, 35598164 - 35598435
Alignment:
| Q |
11 |
cagagacacctgatgatgattgagatgcatcaggacctactgtatctgcttcaagtgtgctacgtgacctagtccttgtttgtgcccgtccattgtcatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35598164 |
cagagacacctgatgatgattgagatgcatcagggcctactgtatctgcttcaagtgtgctacgtgacctagtccttgtttgtgcccgtccattgtcatg |
35598263 |
T |
|
| Q |
111 |
ctggctctcagtaggtccattcagctcatcctgattgctgcatccaactccgtcatcctcaacaattgtattggctcttcgcctctttcctttagaacca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35598264 |
ctggctctcagtaggtccattcagctcatgctgattgctgcatccaactccgtcatcctcaacaattgtattggctcttcgcctctttcctttagaacca |
35598363 |
T |
|
| Q |
211 |
gttgctcgttgactttgcctaggtccagtgtcatcttcagtctctacagcttctgctttgggtactgcaaat |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35598364 |
gttgctcgttgactttgcctaggtccagtgtcatcttcagtctctacggcttctgctttgggtactgcaaat |
35598435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University