View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12396_high_16 (Length: 230)
Name: NF12396_high_16
Description: NF12396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12396_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 23 - 217
Target Start/End: Original strand, 38777701 - 38777895
Alignment:
| Q |
23 |
aatctgtattcactatcacattataccaaggctgactttggcttcagagtgccttttatataatgttgtaaaaggaccatgtacatgattttattaataa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38777701 |
aatctgtattcactatcacattataccaaggctgactttggcttcagagtgccttttatataatgttgtaaaaggaccatgtacatgattttattaataa |
38777800 |
T |
 |
| Q |
123 |
tattcaacatttttgtccagcaacagaatctgtcggtgtctgtactcgtcctttgttaggctgacattgttgttgccaatccttccacttggtct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38777801 |
tattcaacatttttgtccagcaacagaatctgtcggtgtctgtactcgtcctttgttaggctgacattgttgttgtcaatccttccacttggtct |
38777895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University