View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12396_high_6 (Length: 376)
Name: NF12396_high_6
Description: NF12396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12396_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Complemental strand, 5399823 - 5399477
Alignment:
| Q |
1 |
tatcacgaagctcatatctaaaacgccacctaacatccctctccgacttcacactctccccaccattaaacataacggcttcaacattcacaaccgttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5399823 |
tatcacgaagctcatatctaaaacgccacctaacatccctctccgacttcacactctccccaccattaaacataacggcttcatcattcacaaccgttgc |
5399724 |
T |
 |
| Q |
101 |
agaattttgttacaaccgtaaaatccatttaacaccaacaaacattgcagccgttataacggcagcagagttactaggaatgaaagaaggtgacattaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399723 |
agaattttgttacaaccgtaaaatccatttaacaccaacaaacattgcagccgttataacgacagcagagttactaggaatgaaagaaggtgacattaat |
5399624 |
T |
 |
| Q |
201 |
ctacgtgacgtggcagaatcttattttcaaagaattgtttgcatggaagggttaacggttcttcgttcgtgcatggctttgtttcctgaagccgaaacga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5399623 |
ctacgtgacgtggcagaatcttattttcaaagaattgtttgcatggaagggttaacggttcttcgttcgtgcatggctttgtttcctgaagccgaaacca |
5399524 |
T |
 |
| Q |
301 |
cggcgtctcttggtagtagatgtattgaagcattgatttgggaaaac |
347 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5399523 |
cggcgtctcttggtagtagatgtcttgaagcattgatttgggaaaac |
5399477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University