View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12396_high_9 (Length: 278)
Name: NF12396_high_9
Description: NF12396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12396_high_9 |
 | |
|
| [»] scaffold0059 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0059 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 108 - 263
Target Start/End: Original strand, 26895 - 27041
Alignment:
| Q |
108 |
ccacaaaaccagaaccccaattgtagttaataaaattcaacagaaactcatcaataaaaacaagaaaacaatagaatttgaagaagattaccctatcact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26895 |
ccacaaaaccagaaccccaattgtagttaataaaattcaacaaaaacccatcaa---------gaaaacaatagaatttgaagaagattaccctatcact |
26985 |
T |
|
| Q |
208 |
cttgagaagtaatgcagctttccctgtcttaggcttagtagtaacaacagtcacag |
263 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26986 |
cttgagaagtaatgcagctttccctttcttaggcttagtagtaacaacagtcacag |
27041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 13 - 76
Target Start/End: Original strand, 26799 - 26862
Alignment:
| Q |
13 |
tatcgtgtcagatgttcatggctacgcttcttaaggtcatagccaccaacacaattaaatccct |
76 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
26799 |
tatcgtgtcagatgttcgtggctacgcttcttatggtcatagccaccaacacaattaattccct |
26862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University