View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12396_low_10 (Length: 276)
Name: NF12396_low_10
Description: NF12396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12396_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 38777442 - 38777679
Alignment:
| Q |
18 |
tctgctaatcgatcgagtattgagctaataaattaggacgttgggcaaccaaattaatggataagccgctaatcctttcactaggaaaggagaaaacatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38777442 |
tctgctaatcgatcgagtattgagctaataaattaggacgttgggcaaccaaattaatggataagccgctaatcctttcactaggaaaggagaaaacatg |
38777541 |
T |
 |
| Q |
118 |
acaagatggtttcggatgaccgacagagtggtaaggagtttgaatacgtggccccattacccatatggccaaaggcacaagccccgtgaggaggttcgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38777542 |
acaagatggtttcggatgaccgacagagtggtaaggagtttgaatatgtggccccattacccatatggccaaaggcacaagccccgtgaggaggctcgtt |
38777641 |
T |
 |
| Q |
218 |
cactttctatacaaggagcctgccttaccctgttttgg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38777642 |
cactttctatacaaggagcctgccttaccctgttttgg |
38777679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University