View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12396_low_9 (Length: 278)

Name: NF12396_low_9
Description: NF12396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12396_low_9
NF12396_low_9
[»] scaffold0059 (2 HSPs)
scaffold0059 (108-263)||(26895-27041)
scaffold0059 (13-76)||(26799-26862)


Alignment Details
Target: scaffold0059 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: scaffold0059
Description:

Target: scaffold0059; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 108 - 263
Target Start/End: Original strand, 26895 - 27041
Alignment:
108 ccacaaaaccagaaccccaattgtagttaataaaattcaacagaaactcatcaataaaaacaagaaaacaatagaatttgaagaagattaccctatcact 207  Q
    |||||||||||||||||||||||||||||||||||||||||| |||| ||||||         |||||||||||||||||||||||||||||||||||||    
26895 ccacaaaaccagaaccccaattgtagttaataaaattcaacaaaaacccatcaa---------gaaaacaatagaatttgaagaagattaccctatcact 26985  T
208 cttgagaagtaatgcagctttccctgtcttaggcttagtagtaacaacagtcacag 263  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
26986 cttgagaagtaatgcagctttccctttcttaggcttagtagtaacaacagtcacag 27041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0059; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 13 - 76
Target Start/End: Original strand, 26799 - 26862
Alignment:
13 tatcgtgtcagatgttcatggctacgcttcttaaggtcatagccaccaacacaattaaatccct 76  Q
    ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||    
26799 tatcgtgtcagatgttcgtggctacgcttcttatggtcatagccaccaacacaattaattccct 26862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University