View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12397_high_2 (Length: 436)
Name: NF12397_high_2
Description: NF12397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12397_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 88 - 426
Target Start/End: Original strand, 29473920 - 29474258
Alignment:
| Q |
88 |
aaaaaatgggattggagttaaatttccactcaaaaaatgtgttttttcagttttatatgattttattgtttagtcttggaatcttctttgtaagttcaat |
187 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29473920 |
aaaaaatgggattggagttaagtttcagctcaaaaaatgtgttttttcacttttacatgattttattgtttagtcttggaatcttctttgtaagttcaat |
29474019 |
T |
|
| Q |
188 |
caatgaagaaggttcaactcttttgaagtttacaattactcttttagattcagataacaatcttgttaactggaatccttctgattcaactccatgcaat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29474020 |
caatgaagaaggttcaactcttttgaagtttacaattactcttttagattcagataacaatcttgttaactggaatccttctgattcaactccatgcaat |
29474119 |
T |
|
| Q |
288 |
tggactggtgtgtcttgcactgattcattggtaacttctgttaatctttaccaccttaatctttctggtagtttgtcacctactatatgtaatcttccat |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29474120 |
tggactggtgtgtcttgcactgattcattggtaacttctgttaatctttaccaccttaatctttctggtagtttgtcacctactatatgtaatcttccat |
29474219 |
T |
|
| Q |
388 |
atttagttgagttgaatctttccaaaaatttcatctctg |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29474220 |
atttagttgagttgaatctttccaaaaatttcatctctg |
29474258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University