View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12399_high_27 (Length: 242)
Name: NF12399_high_27
Description: NF12399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12399_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 38 - 229
Target Start/End: Complemental strand, 2209768 - 2209577
Alignment:
| Q |
38 |
aattttaccttattcaaagaagatataattgtgataccgctttcttaatagaggtcgtataaacattcgggttttacttccaccttaaccgcttgtaatc |
137 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2209768 |
aattttaccttattcaaaaaagatatatttgtgataccgctttcttaatagaggtcgtataaacattcgggttttacttccaccttaaccgcttgtaatc |
2209669 |
T |
|
| Q |
138 |
tcaaacagaatataatccataacggtgaagagactagccaaatcaagcgaaatataaacgatctagccaaacaaaaacaggaaaagaacaca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2209668 |
tcaaacagaatataatccataacggtgaagggactagccaaatcaagcgaaatataaacgatctagccaaacaaaaacaggaacagaacaca |
2209577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University