View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12399_high_34 (Length: 222)
Name: NF12399_high_34
Description: NF12399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12399_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 34749965 - 34749772
Alignment:
| Q |
1 |
catacaatcgcaatctcatccagcgaatgacagcaaaaccacccattggaaccccagcacgccccggtgtcccaataacaaccttcctcttctcactttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749965 |
catacaatcgcaatctcatccagcgaatgacagcaaaaccacccattggaaccccagcacgccccggtgtcccaataacaaccttcctcttctcactttt |
34749866 |
T |
 |
| Q |
101 |
cgacgaaaaccaaaagccaggtcccggaacagaacgacactggggcttattacacacagatggaaccccaatttacgatctagacttaacaggt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749865 |
cgacgaaaaccaaaagccaggtcccggaacagaacgacactggggcttattacacacagatggaaccccaatttacgatctagacttaacaggt |
34749772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 4 - 175
Target Start/End: Complemental strand, 26593350 - 26593179
Alignment:
| Q |
4 |
acaatcgcaatctcatccagcgaatgacagcaaaaccacccattggaaccccagcacgccccggtgtcccaataacaaccttcctcttctcacttttcga |
103 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||||||||| || | ||| ||| |||| |||||||| ||| | |||||| ||||||||| |||| | |
|
|
| T |
26593350 |
acaatcccaatctcatccaaagaatgacaacaaaaccaccaatcgaaacaccaatgtgccctggtgtccccatacccaccttcatcttctcacctttcaa |
26593251 |
T |
 |
| Q |
104 |
cgaaaaccaaaagccaggtcccggaacagaacgacactggggcttattac-acacagatggaaccccaattta |
175 |
Q |
| |
|
| |||||||||| ||||||||||| ||| | | ||||||||| ||||||| ||||||| |||||||| |||| |
|
|
| T |
26593250 |
caaaaaccaaaaaccaggtcccgggacacagcaacactgggg-ttattactacacagacagaaccccagttta |
26593179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University