View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12399_high_36 (Length: 215)
Name: NF12399_high_36
Description: NF12399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12399_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 19 - 164
Target Start/End: Original strand, 33112549 - 33112697
Alignment:
| Q |
19 |
aaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacactggtaattacactacaacc-tttttcttt--gt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
33112549 |
aaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacactggtaattacactacaaccttttttcttttggt |
33112648 |
T |
|
| Q |
116 |
tttcctatgtttcaatctctcatgttatcaaccatttgtctatgtaaca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
33112649 |
tttcctatgtttcaatctctcatgttatcaaccattagtctatttaaca |
33112697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 33110888 - 33110946
Alignment:
| Q |
28 |
atgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacact |
86 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
33110888 |
atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatgacact |
33110946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 91
Target Start/End: Complemental strand, 21496796 - 21496724
Alignment:
| Q |
19 |
aaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacactggtaa |
91 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||| || |||||||| |
|
|
| T |
21496796 |
aaaatccttatgttcttcgtcttgctttttctgctggaattggtggccttctttttggctatgatactggtaa |
21496724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 92
Target Start/End: Complemental strand, 21562846 - 21562773
Alignment:
| Q |
19 |
aaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacactggtaat |
92 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |||||||| ||||||||||||| || ||||||||| |
|
|
| T |
21562846 |
aaaatccttatgttcttcgtcttgctttctctgctggaattggtggttttctctttggctatgatactggtaat |
21562773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 51032225 - 51032287
Alignment:
| Q |
19 |
aaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacg |
81 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
51032225 |
aaaatccttatgttcttcgtcttgctttttctgctggaattggtggacttctttttggctacg |
51032287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University