View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12399_low_14 (Length: 355)
Name: NF12399_low_14
Description: NF12399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12399_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 41472721 - 41472452
Alignment:
| Q |
19 |
ttagttattcagaatgtgtttgcatttatattaatcgattgattatgatgtctttgtaaatatagcaagattcaaacgcgtacaagttgtgtcagtttag |
118 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41472721 |
ttagatattgagaatgtgtttgcatttatattaatcgattgattatgatgtctttgtaaatatagcaagattcaaacgcgtacaagttgtgtcaatttag |
41472622 |
T |
|
| Q |
119 |
gagcaagagttcgacgttgaagaattatctagatatgatgtatataatgcattctctcatccagaaaactgaatt-gaattgccttcatgtttaagaatt |
217 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
41472621 |
tagcaagagctccacgttgaagaattatctaga-------tatataatgcattctctcatccagaaaacggaattggatttgccttcatgtttaagaatt |
41472529 |
T |
|
| Q |
218 |
ttggtcacattggcttttgcatctg-ttttttattgcagatatggttgcctctgcaaaaagaatggctactccgaaa |
293 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
41472528 |
ttggtcacattggcttttgcatctgtttttttattgctgatatggttgccactgcagaaagaatggctactctgaaa |
41472452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 250 - 341
Target Start/End: Original strand, 4218316 - 4218407
Alignment:
| Q |
250 |
ttgcagatatggttgcctctgcaaaaagaatggctactccgaaacataagatattggtcttgttcggaaatggagctgttggtaagagcaca |
341 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| ||||||||||||| ||||||||| ||||| |||| |||||| ||||||||| |
|
|
| T |
4218316 |
ttgcagatatggttgccattgccgaaagaatggccactgtgaaacataagatactggtcttgtcaggaaagggaggtgttggcaagagcaca |
4218407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 250 - 341
Target Start/End: Complemental strand, 5939127 - 5939036
Alignment:
| Q |
250 |
ttgcagatatggttgcctctgcaaaaagaatggctactccgaaacataagatattggtcttgttcggaaatggagctgttggtaagagcaca |
341 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| ||||||||||||| ||||||||| ||||| |||| |||||| ||||||||| |
|
|
| T |
5939127 |
ttgcagatatggttgccattgctgaaagaatggccactgtgaaacataagatactggtcttgtcaggaaagggaggtgttggcaagagcaca |
5939036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University