View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12399_low_33 (Length: 232)
Name: NF12399_low_33
Description: NF12399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12399_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 8288343 - 8288544
Alignment:
| Q |
15 |
agagaggggagaagaagaaggaatgctgtggaactctaacttatgacacgaggtccacgatttggatgtttgttgtcacattaaaacatacactttagaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8288343 |
agagaggggagaagaagaaggaatgctgtggaactctaacttatgacacgaggtccacgatttggatgtttgttgtcacatcaaaacatacactttagaa |
8288442 |
T |
|
| Q |
115 |
gttttatgaatccaaacaaacaaaatgcaagttaaaatagaatttcctatatttgcagctatcaataaaatcagcatggtattgtattagatgagatatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288443 |
gttttatgaatccaaacaaacaaaatgcaagttaaaatagaatttcctatatttgcagctatcaataaaatcagcatggtattgtattagatgagatatt |
8288542 |
T |
|
| Q |
215 |
ct |
216 |
Q |
| |
|
|| |
|
|
| T |
8288543 |
ct |
8288544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University