View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12399_low_34 (Length: 228)
Name: NF12399_low_34
Description: NF12399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12399_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 162
Target Start/End: Original strand, 41114449 - 41114588
Alignment:
| Q |
23 |
gaacagaattggattcgaaattcaaaatgcagagcaagggatcgagtcacagactctccactatggcgaatcgatctcgaatccctgcactcttcatctc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41114449 |
gaacagaattggattcgaaattcaaaatgcagagcaagggatcgagtcacagactctccactatggcgaatcgatctcgaatccctgcactcttcatctc |
41114548 |
T |
|
| Q |
123 |
catgtttgccactttcgcttctatctacgtcgccggaagg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41114549 |
catgtttgccactttcgcttctatctacgtcgccggaagg |
41114588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University