View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12399_low_38 (Length: 202)
Name: NF12399_low_38
Description: NF12399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12399_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 49766940 - 49767101
Alignment:
| Q |
1 |
gatgaaacagcatgaataggaagagggaaagaagaagaaacgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49766940 |
gatgaaacagcatgaataggaagagggaaagaagaagaaacgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctat |
49767039 |
T |
|
| Q |
101 |
atggatgatcaatgcattgcatgccatcaatggaatcatcttcaacaccaatgttaactctt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767040 |
atggatgatcaatgcattgcatgccatcaatggaatcatcttcaacaccaatgttaactctt |
49767101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 28 - 89
Target Start/End: Complemental strand, 14137768 - 14137707
Alignment:
| Q |
28 |
aaagaagaagaaacgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagg |
89 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
14137768 |
aaagaagaagaaacaagtttaccaagtttttcttgaagacaaaaagcacatataccaccagg |
14137707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University