View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12400_low_6 (Length: 210)
Name: NF12400_low_6
Description: NF12400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12400_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 23 - 191
Target Start/End: Original strand, 45566215 - 45566383
Alignment:
| Q |
23 |
gggaaatgatctgaacggtgtgaaatgacatcatgaagttgtcattgtggaaaaatatcatattaagtttttgtgaccactgcttggtccggtctctcct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
45566215 |
gggaaatgatctgaacggtgtgaaatgacatcatgaagttgtcattgtggaaaaatatcatattaagtttgtgtgaccactgctcggtccggtctctcct |
45566314 |
T |
 |
| Q |
123 |
cctagaaattttgcctaccaagacctttaacccaagtaaacggataatcagcaagggaaatgtcattta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45566315 |
cctagaaattttgcctaccaagacctttaacccaagtaaacggataatcagcaagggaaatgtcattta |
45566383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University