View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12401_high_2 (Length: 311)
Name: NF12401_high_2
Description: NF12401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12401_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 306
Target Start/End: Complemental strand, 4934945 - 4934648
Alignment:
| Q |
12 |
aacctgtgcaggaacctaatctctaagctacactagacaacaagttacaatgcatgccaactcattcactccactgagtttgttttggaatagatacata |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4934945 |
aacctgtacaggaacctaatctctaagctacactagacaacaagttacaatgcatgccaactcattcactccactgagtttgttttggaatagatacata |
4934846 |
T |
 |
| Q |
112 |
gtaagaagtatgaacctgaaaggaaacataatatc---aacnnnnnnnnnnnnnnnnnnnnntatacagatttgcatgtaaaaactaactaatccattgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4934845 |
gtaagaagtatgaacctgaaaggaaacataatatcaacaacaaaaactaaaaactaaaaaaatatacagatttgcatgtcaaaactaactaatccattgc |
4934746 |
T |
 |
| Q |
209 |
aattggcaataaaactaaaaaattgcagcagatcaaacatatagatgttgtgaacaaaaccaaaaggcgaaacaaacaaagcatgcacctttgcttct |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
4934745 |
aattggcaataaaactaaaaaattgcagcagatcaaacatatagatgttgtgaacaaaaccaaaaggcgaaacaaacaaagtatgcaccttttcttct |
4934648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University