View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12402_low_10 (Length: 241)
Name: NF12402_low_10
Description: NF12402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12402_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 7775859 - 7776061
Alignment:
| Q |
19 |
atatatagttcgttggacataatagaattattctacctatcaaagtccatctaaaagcaaagttcattcaaataattcatcaataactaatactatagta |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7775859 |
atatatagttcattggacataatagaattattctacctatcaaagtctatctataaacaaagttcattcaaataattcatcaataactaatactatagta |
7775958 |
T |
 |
| Q |
119 |
cttcctaacaatttatcataatgttaacaaattctaattgattatggcaatcaaaacttaattaaataattaatctaacataaatgattgtaattgagac |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7775959 |
cttcctaacaatttatcatattgttaacaaa---taattgattatggcaatcacaacttaattaaataattaatctaacataaatgattgtaattgagac |
7776055 |
T |
 |
| Q |
219 |
ggacac |
224 |
Q |
| |
|
|||||| |
|
|
| T |
7776056 |
ggacac |
7776061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University