View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12403_high_1 (Length: 380)
Name: NF12403_high_1
Description: NF12403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12403_high_1 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Original strand, 45550349 - 45550728
Alignment:
| Q |
1 |
gagtaataggcagacttttggttttggaggaccaaatttttatctggaccaccaaacatcatggttttgaaggatccaacagccactttttggtttttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550349 |
gagtaataggcagacttttggttttggaggaccaaatttttatctggaccaccaaacatcatggttttgaaggatccaacagccactttttggtttttga |
45550448 |
T |
 |
| Q |
101 |
tcaaattgtctgtttgtttgctcttcagtgtggtgctgctgcttcctttggcagagtgtttggatgatgcagtattacaattaccagaaaccttcttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550449 |
tcaaattgtctgtttgtttgctcttcagtgtggtgctgctgcttcctttggcagagtgtttggatgatgcagtattacaattaccagaaaccttcttctc |
45550548 |
T |
 |
| Q |
201 |
aggaaggttgtccagtcccattagtttggctattacgtttggaatccttcccttgtcggccatctggtttgaaatgtcggcagctctgccagtgttagtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550549 |
aggaaggttgtccagtcccattagtttggctattacgtttggaatccttcccttgtcggccatctggtttgaaatgtcggcagctctgccagtgttagtt |
45550648 |
T |
 |
| Q |
301 |
gatgttcgcttccgctgagaatcttttatctttctggtttccttagagttagtgattgtaattgctctctgcatcttgtt |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45550649 |
gatgttcgcttccgctgagaatcttttatctttttggtttccttagagttggtgattgtaattgctctctgcatcttgtt |
45550728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University